EST details — SGN-E472633
| Search information |
| Request: 472633 | Match: SGN-E472633 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C220954 | Clone name: cSTB-29-M8 |
| ||
| Library Name: cSTB | Organism: Solanum tuberosum |
Tissue: leaves and petioles
Development Stage: 8 weeks old plants
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E472633 | Length: 183 bp (911 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E472633 [] (trimmed)
GGATGGGCAGCTTCATGTACATTGCGATCTTACTTCTTGCCATAATCTCAACCGTTCATTCCTGCCCGCCATCAGATCGGGCAGCATTATTATCT
TTCCGAGCTGCCCTAAATGAATCTTACTTAGGAATTTTCAACTCATGGAAAGGCTACGACTGTTGCCATGAATGGTACGGGGTGAGTT
TTCCGAGCTGCCCTAAATGAATCTTACTTAGGAATTTTCAACTCATGGAAAGGCTACGACTGTTGCCATGAATGGTACGGGGTGAGTT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E472633] | SGN-U276294 | Solanum tuberosum | Build 4 | 5 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T217854 [Download] [View] | Facility Assigned ID: PSHEJ76TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.985 | Expected Error Rate: 0.0009 | Quality Trim Threshold: 14.5 |
Working
