EST details — SGN-E473576

Search information 
Request: 473576Match: SGN-E473576
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C222166Clone name: cSTB-33-I7
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E473576Length: 488 bp (822 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E473576 [] (trimmed) CTAAAAGGGAGTCGCCGTTGACACTGTATTCGGAAGAAGAGGGCAAACTATGGGGGAAATGGCAGAGAATGACGAGTTTTACCTGAGATATTACG
TGGGTCACAAAGGAAAATTCGGTCACGAGTTCTTAGAGTTTGAGTTTAGGCCTGATGGCAAGCTCCGTTATGCTAACAATTCCAACTACAAGAAC
GATACAATGATTCGCAAGGAAGTCTTCCTTACCCCTTCTGTTCTCAAAGAATGCCGCCGCATTGTTGCTGATAGCGAGATCATGAAGGAAGATGA
TAACAACTGGCCAGAACCAGATAGAGTTGGTAGACAAGAGCTTGAGATTGTGATGGGAAATGAACACATATCATTCACTACATCTAAGATTGGTT
CATTAATGGATGTGCAGACCAGTAATGATCCCGAGGGACTTCGCATCTTCTATTATCTTGTTCAGGATCTGAAGTGTTTTGTGTTCTCTCTCATC
TCACTCCATTTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E473576] SGN-U268176 Solanum tuberosum Build 4 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T218797 [Download] [View] Facility Assigned ID: PSHEY52TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0200 Quality Trim Threshold: 14.5