Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

EST details — SGN-E473708

Search information 
Request: 473708Match: SGN-E473708
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C222162Clone name: cSTB-33-I20
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E473708Length: 587 bp (860 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E473708 [] (trimmed) GGCACTGTATCTTCTTCAGGATGTTATCTCAAAGTTGGACCTCAAAATAAGACTTTGTATCAGAGATAGCTTGTTCCGACTGGCTCAAAGTGCTA
CACAGAGGCAATGTGGCAATGATAGTTGCGGCACTAAGAAAGGTGGAAGAGAAGTCAGCAAGGAAGAGATAAACACCGATAACAGACCACCCCAT
GTTGAGACCGAGACGAATCCAATAGACCGCACTGTAGCTCATCTGCTCTTCTACAATCCATCAGAGTTGCCGTCAAAACTTGCTGAATTTCCCAA
GTCATCAATGTTTTCAATGCTCAATTGTGAAAGAGAAGCAATTGGTTCACCAAGCTTCCCAAGCAGATTTTCACAACAGAATTCTGAAACTAATT
GAACCACAGCTCTCCAGGGACCAAAAGCTTCTACCTCATATAATGAAGTGGATATAATGAGAAGTAGCCCCTGCACTGAGACTTCTGAGAATGCA
TCAAACAATGAAGGAGCAGATGGTAGTGTTATTGGAGTTGAAGCCACATCGTGAAACAATCCTATCATCAGATATATTCAACTGGACATTGAGCA
ACCATGACTCCATGAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E473708] SGN-U274933 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T218929 [Download] [View] Facility Assigned ID: PSHEZ58TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0128 Quality Trim Threshold: 14.5