Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E473945

Search information 
Request: 473945Match: SGN-E473945
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C222296Clone name: cSTB-34-A24
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E473945Length: 696 bp (957 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E473945 [] (trimmed) GCCAGATTCACCATGAGTAATGATTTGTGGTATGGACCTGACCGTGTCAAGTACTTGGGACCATTTTCTGCTCAAACTCCTTCATACTTGACTGG
AGAATTCCCTGGTGATTACGGATGGGATACTGCTGGTTTATCTGCTGATCCCGAGGCCTTTGCCAAGAACCGAGCTCTTGAGGTTATCCATGGGA
GATGGGCCATGCTTGGGGCTTTTGGTTGCATTACACCAGAAGTTCTTGAAAAATGGGTAAAAGTGGACTTCAAAGAACCAGTATGGTTCAAAGCT
GGAGCCCAAATCTTCAGTGAAGGTGGGCTGGACTATTTGGGCAACCCAAACCTTGTCCATGCTCAGAGCATTCTAGCAGTATTGGGCTTCCAAGT
AGTACTAATGGGCCTTGTAGAAGGTTTCAGAATTAATGGGCTTCCTGGAGTTGGTGAAGGCAACAATCTATACCCAGGTGGTCAGTACTTTGACC
CATTGTGCCTAGCAGATGACCCAACAACTTTCGCCGAGCTCAAGGTTAAGGAGATCAAGAACGGAAGATTAGCTATGTTCTCCATGTTTGGATTC
TTCGTTCAAGCTATTGTTACCGGCAAAGGCCCACTTGAGAACCTATTGGATCACCTTGACAACCCTGTTGCTAACAATGCATGGGTTTATGCAAC
TAAATTTGTTCCTGGTTCTTAAATTTTTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E473945] SGN-U269119 Solanum tuberosum Build 4 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T219166 [Download] [View] Facility Assigned ID: PSHFD12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0167 Quality Trim Threshold: 12.5