EST details — SGN-E474317

Search information 
Request: 474317Match: SGN-E474317
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C222881Clone name: cSTB-36-K1
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E474317Length: 289 bp (465 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E474317 [] (trimmed) GTTCATCTAGCATTAGTTGAGGAGTTAAAACTTCCCAAACATGATTTGGTGGATGGAAGTGTAAGGGATACCCGGCAGGTTCAGTGGGAGAAGGT
CTTTACTAATTGCTTTCTCAAGGTTGATGATGAAGTTGGAGGAAAGGTGAACATAGATCTTTGTGATGACAACATGAATACCTCTAGCTGCACCT
CTGAGCCTATTGCCCCAGAAACTGTTGGGTCCACTGCGGTTGTAGCGGTGATTTGTTCATCTCATATTATAGTTGCTAACTGTGGGGATTCAAGA
GCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E474317] SGN-U273187 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T219538 [Download] [View] Facility Assigned ID: PSHFK61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0001 Quality Trim Threshold: 14.5