EST details — SGN-E475843

Search information 
Request: 475843Match: SGN-E475843
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C224312Clone name: cSTB-41-P14
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E475843Length: 379 bp (932 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E475843 [] (trimmed) AAACAATTCAAGGTCAGAGTGCAACAACAGCCTTGACGATGGAGGTGGCAAGGGTACAAGCAATATCGTCAATAACGAAATGCATGGACACAATA
CCATCAGAATATATTCGTTCAGAGAACGAACAACCTGCAGCGACAACGCTGCAGGGAGTGGTACTTGAAGTACCAGTCATCGACATAAGTAATGT
CGATGACGACGAAGAAAAGTTAGTGAAAGAAATAGTTGATGCTAGTAAAGAGTGGGGTATTTTTCAAGTGATAAATCATGGGATACCTGATGAAG
TGATTGAGAATTTGCAGAAAGTTGGAAAGGAGTTTTTTGAGGAAGTGCCACATGAGGAAAAAGAATTGATTGCAAAGAAGCCAGGGGCACAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E475843] SGN-U275099 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T221064 [Download] [View] Facility Assigned ID: PSHGH91TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0163 Quality Trim Threshold: 14.5