EST details — SGN-E476150
| Search information |
| Request: 476150 | Match: SGN-E476150 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C224661 | Clone name: cSTB-43-B7 |
| ||
| Library Name: cSTB | Organism: Solanum tuberosum |
Tissue: leaves and petioles
Development Stage: 8 weeks old plants
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E476150 | Length: 206 bp (947 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E476150 [] (trimmed)
AATACAGAGATGGACAAAGTATACACTGTCATGGGTGTATGCCCTCAGCATGACTTGCTTTGGGATACATTAACAGGAAGGGAGCACCTACTTTT
CTATGGAAGGCTTAAAAATCTTAAAGGAGAAGTTTTACATCGAGCAGTTGAAGACTCTCTTAAGAGTCTCAACTTGTTTAACGGAGGCGTTGCTG
ACAAGCAATCTGGGAG
CTATGGAAGGCTTAAAAATCTTAAAGGAGAAGTTTTACATCGAGCAGTTGAAGACTCTCTTAAGAGTCTCAACTTGTTTAACGGAGGCGTTGCTG
ACAAGCAATCTGGGAG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E476150] | SGN-U293780 | Solanum tuberosum | Build 4 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T221371 [Download] [View] | Facility Assigned ID: PSHGO04TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.971 | Expected Error Rate: 0.0274 | Quality Trim Threshold: 14.5 |
Working
