Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E476565

Search information 
Request: 476565Match: SGN-E476565
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C225266Clone name: cSTB-45-E12
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E476565Length: 500 bp (913 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E476565 [] (trimmed) AGGAAACCCTTCAAAACCCCTTAAAGCCATTTCCAGCTTCTCATCTTCTCCAATGGCGTCCGTCGTTTTCAAGAATCCCAATTCGAAGCGCGTAT
TGTCACTCTCTCCTCAAATCTACTCATGTTGTAGAGGAGGATCAGTTTCCTCTCAGTTTTCACTCTCCCAGACGCAAAATGGAAATGATACTTCC
AGTCTTTCTAATCCATGGTGGAGATCCATGGCCACCTTCAATCGAACAAAACCTCATGTAAATGTGGGAACTATAGGCCATGTTGATCACGGGAA
GACTACTCTTACTGCTGCAATTACAAAGGTCCTAGCAGATGAAGGAAAGGCCAAGGCGGTTGCATTTGATGAAATTGACAAAGCCCCTGAAGAGA
AAAAGAGAGGAATTACTATTGCTACAGCCCACGTGGAGTATGAGACAGCTAAAAGACATTATGCTCATGTTGACTGCCCAGGACACGCGGATTAC
GTTAAAAATATGATTACTGGAGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E476565] SGN-U273682 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T221786 [Download] [View] Facility Assigned ID: PSHGV30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0049 Quality Trim Threshold: 20.5