Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E477201

Search information 
Request: 477201Match: SGN-E477201
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C225814Clone name: cSTB-47-D1
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E477201Length: 638 bp (896 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E477201 [] (trimmed) ATTTTATATATCTAGCTATTTTCTTTGTGTTATTTTTTTTATTTTTTATTTGTTGAAATGGCAAAATCCCCAGAAGAAGAACATCCAATTAAGGC
TTTTGGATGGGCAGCTAGAGATACTTCTGGTGTTCTTTCTCCTTTCAACTTCTCAAGAAGGGCTACTGGGGAGAAAGATGTGCAATTCAAGATCT
TGTATTGTGGAGTTTGCCACACAGATCTTCACTTTCTCAAGAATGAATGGGGAGTCACAAGATATCCTGTTGTACCTGGGCATGAGATTGTGGGT
GTAGTGACAGAAGTTGGTAACAAAGTTGATAAATTTAAGATTGGTGACAAAATTGGTGTTGGATGTCTAGTAGGATCATGTCAAAAATGTGACAA
TTGTGCAAATGATCTTGAAAATTATTGTCCCAAACAAATACAAACATATGGTCAAATGTACATCGATGGAACGATGACGTATGGTGGTTACTCCG
ATATCATGGTTGTCGATGAGCATTTCGCGGTCCGTTGGCCGGAGAATTTACCGATGGAAGCTGCACCATTGTTATGTGCTGGTATCACAACTTAT
AGCCCATTGAAGTATTATGGGCTTGATAAGCCTGGTTTGAACATTGGTGTGGTGGGCCTTGGTGGGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E477201] SGN-U270262 Solanum tuberosum Build 4 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T222422 [Download] [View] Facility Assigned ID: PSHHE13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0075 Quality Trim Threshold: 14.5