EST details — SGN-E477595

Search information 
Request: 477595Match: SGN-E477595
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C227158Clone name: cSTD-1-I23
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E477595Length: 510 bp (906 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E477595 [] (trimmed) TGGAGCTTCTACAAGAATTTTTCGTCTGTGCCAGCATTCACCGGAACACCATTCTTGACATTCGAAATAAACAATTTGCTTCAACTCTGCAGCAA
TTCCAAATCAGTAGACCAAGGCAAACAAACCCATCAACAAATCATCGTACGTGGTCAAAGCCACAATCCATTCATCATCACCAAATTGATACAAG
TATATACAGAACGCGACGATATTAAATCTGCCCAGAACCTGTTTGTCAAATTGTCTCAAAGAAATGTGTATGCCTGGACCGCCATGATATCGTAT
TTTTCACGTAACCGCCTAATTAAAGAATGTGTAAATACTTATAAGGAGATGAAACTGAACAACATTTTACCCGATGGGTATGTGTTTCCTCTAGT
ACTGAGGGTTTGTGCTAAGTTTTCGAGCTCGGGTATTGGGGTACAAGTGCACAGAGATATAATTGTGTGTGGTGTAGAATGGAATCTCCAAGTTA
GTCATTCTTTAATTGATATGTACTCTAAATGTTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E477595] SGN-U286493 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T222816 [Download] [View] Facility Assigned ID: PTDAA60TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0029 Quality Trim Threshold: 20.5