EST details — SGN-E477630
Search information |
Request: 477630 | Match: SGN-E477630 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C227003 | Clone name: cSTD-1-A2 |
| ||
Library Name: cSTD | Organism: Solanum tuberosum |
Tissue: dormant tuber
Development Stage: one month post harvest
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E477630 | Length: 173 bp (820 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E477630 [] (trimmed)
TTTTTTTTTTGTCTCTATTGTTTTGTTTATGAAATTAACAACAAATAAAAAGACTTATTATTTACATACATATACNTCTTGACCATCGCCTAATA
GCATTTGCTTATATTTTGAAGTGTTTGATACTTTTAAGTTCAAAAAAATAATTGAAGATAAACATGACTCCTCTTACT
GCATTTGCTTATATTTTGAAGTGTTTGATACTTTTAAGTTCAAAAAAATAATTGAAGATAAACATGACTCCTCTTACT
Unigenes |
Current Unigene builds | |||||
[SGN-E477630] | SGN-U271678 | Solanum tuberosum | Build 4 | 10 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T222851 [Download] [View] | Facility Assigned ID: PTDAB01TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.876 | Expected Error Rate: 0.0206 | Quality Trim Threshold: 14.5 |