EST details — SGN-E477974

Search information 
Request: 477974Match: SGN-E477974
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C229813Clone name: cSTD-2-F7
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E477974Length: 403 bp (999 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E477974 [] (trimmed) AAAGCCCACAAATGTCCTTCTTTCATTAGTACACACTTGCCAATATTCAACACAAATGCCTTCTTCAAAATTTGAACCAAATGATGACATATTTG
ATTTTGTAATCAAGAAAGCAAATGGACTAAAAGGCATAGCAGACACAAGCCTTGAAATTATCCCAAATCAATGCATTCAACCAAAAGAACAAAGA
CTAGACAAATCCCAAATTGACAATCAAGAATCAATCCCCACAATTGATCTGTCAAATTTTGATGATTTAAATGTTGAAAAATCAATTCAAGAAGC
ATCAAGCAAGTGGGGTTGCTTCCAAATCATCAATCATGGCATCCCAATTGAAGTTCTTGAAGATTTGAAAGAAGCAGGACACAAATTCTTTGAAT
TGCCGGCTGAAGAAAAAGTTAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E477974] SGN-U269496 Solanum tuberosum Build 4 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T223195 [Download] [View] Facility Assigned ID: PTDAG28TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.893 Expected Error Rate: 0.0138 Quality Trim Threshold: 14.5