EST details — SGN-E478463

Search information 
Request: 478463Match: SGN-E478463
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C231066Clone name: cSTD-5-E7
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E478463Length: 526 bp (891 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E478463 [] (trimmed) AAGATATCCACTTCCTGTGATCGAGCTTTTCTTTCTAGTTTGTTTTATTTTTCTAATAAATAAGAGTAATAATGGCTTGCACAATTCTTACATCT
TCTGCATTAGCGTCCAATGTCAGTGTTGGTGGAACCTCTAGGATTAACAAAAATGTAGCTGCACCTTGCTCTGTTTTCTTTCCTTCCATGTTATT
GCCGATGACTAGGCTGGTAGCTCAGGCCACCGGAGATAACAAAGATACATCAGTCGACGTACACCACAAAAGCGCTCAAGGAGGAAACAACCAAG
GCACTGCTGTCGAACGCCGTCCTACGAGGATGGCTCTTGATGTTTCCCCTTTTGGAGTGTTGGACCCGATGTCACCAATGAGAACAATGCGGCAG
ATGATAGATACTATGGACAGATTATTCGAGGATACAATGACATTTCCAGGAAGAAACAGAGCATCAGGAGCAGGGGAAATACGCACTCCTTGGGA
CATTCATGATGATGAAAACGAAATCAAGATGCGATTCGACATGCCCGGGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E478463] SGN-U274067 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T223684 [Download] [View] Facility Assigned ID: PTDAQ28TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0066 Quality Trim Threshold: 14.5