Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E478484

Search information 
Request: 478484Match: SGN-E478484
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C231112Clone name: cSTD-5-K15
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E478484Length: 511 bp (968 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E478484 [] (trimmed) GAGAGAGAGAACTAGTCTCCTGTTTTCTACAGTCTCTTTTTTTAAAAAAAAAATTCTAGATAACTATGGGTAGTNTTGGAAGTTGAGAAAACAGC
TATTGGCTGGGCTGCAAGAGATCCTTCTGGTGTACTTTCACCTTATACCTACACTCTAAGAAACACAGGGCCTGATGATGTGCAAGTCAAAATTT
TGTACTGTGGACTTTGTCACAGTGATCTTCACCAGGTTAAAAATGATCTTGGCATGTCCAATTACCCTATGGTTCCTGGACATGAAGTTGTTGGA
GAAGTGGTGGAGGTAGGGCCAGAGGTAACAAAATTCAAAGTGGGGGATATAGTTGGAGTTGGATTGCTTGTTGGATGTTGCAAGACTTGCAGGCC
TTGCAAGCAAGACATTGAGCAATATTGTGCTAAGAAGATATGGAATTGCAATGATGTCTACACTGATGGCAAGCCAACCCAAGGTGGTTTTGCTA
ATTTCATGGTTGTTGAACAAAAATTTGTGGTGAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E478484] SGN-U273888 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T223705 [Download] [View] Facility Assigned ID: PTDAQ68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0132 Quality Trim Threshold: 14.5