EST details — SGN-E479021

Search information 
Request: 479021Match: SGN-E479021
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C231563Clone name: cSTD-8-A2
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E479021Length: 268 bp (856 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E479021 [] (trimmed) CGAGGCCGAGGACCAAGAACGAAGAGGAGTGTAGGCCTTGGCGTAAGAGGTTATCAATGGCTTTTCATTGGTCTTCTCTTTTCAAATTCACTTTT
CTTCTTCTCCTTCTCGCTGCAATTGCCACCGCTTGTTTCACTCTCCCCGTTGAAAAGATACCTGAAAGATTTCTTGCAATGGATTGAGCAAGATC
TTGGTCCTTGGGGTCCCCTTGTCCTGGCTGTTGCATACATTCCTCTTACAGTATTGGCAGTTCCTGCATCAGTTCTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E479021] SGN-U277393 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T224242 [Download] [View] Facility Assigned ID: PTDBD01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0197 Quality Trim Threshold: 14.5