EST details — SGN-E479278

Search information 
Request: 479278Match: SGN-E479278
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C231869Clone name: cSTD-9-G16
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E479278Length: 514 bp (928 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E479278 [] (trimmed) TCTCAAGATCAGTAACCTGTCTCTCTCTCAACAAACCCAACAATCAAAGCACCAATGCATCCGGAGAAGCACCTGCTACAACTGACACCCTTCGA
ATCATATTGGCTGCAGGGGGCACCGGAGGCCATATTTATCCGGCGATTGCCATTGCTGACGACCTTAAAGTCCTTGACCCAAATGCCCAAATTCT
CTTTGTTGGACTTCAAACTGGAATGGAAAGCACCGCAGTGCCAACAGCAGGATACTCCTTTGAACCGATTCCTGCTGCACCATTAGGCCGGCCCT
TTTTCTCTCTCTACAACTTATTCGTCCTCCCTTTTGTTCTCGTCAAATCCCTAATTAAAAGTTCCCAAATATTTAAAGAATTCAAACCCCATATA
GTAATTGGAACTGGGGGGTTTTGTTTCATTTCCAATTTGCTTAGCTGCAAGTCTCAAAGGCATTAAACTTGCAATTCAAGAACAAAATTCAGTAC
CCGGAATCGCTAATCGGGTGCTTTCTTTATTTGCATATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E479278] SGN-U279282 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T224499 [Download] [View] Facility Assigned ID: PTDBH44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0038 Quality Trim Threshold: 20.5