EST details — SGN-E479376

Search information 
Request: 479376Match: SGN-E479376
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C231968Clone name: cSTD-9-L21
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E479376Length: 273 bp (1098 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E479376 [] (trimmed) CAGCTTTGGCTTCTTCAAGAATTCCTAAAAGCACAAGGCTTCCTTCCAATAAGAACTCCTTCTTATTCCCCACACAATGTTTATCCAAGAAATTT
GAAGTAGCTGAATTTTCTGGTCTTAGATCAAGTGGATGTGTGACATTTTCCAACAGAGAGTCTTCTTTCTTTGATGTTGGCTCTGCTCAACTCAC
TCCAAAGACCACAGGATCAGCCCCGGTTAAGGGAGAAACTGTTGCTAAATTGAAAGGTGCTATCAACGGTTTTGGTAGAATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E479376] SGN-U269582 Solanum tuberosum Build 4 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T224597 [Download] [View] Facility Assigned ID: PTDBI71TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0130 Quality Trim Threshold: 14.5