EST details — SGN-E480152

Search information 
Request: 480152Match: SGN-E480152
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C227956Clone name: cSTD-12-L22
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E480152Length: 641 bp (1029 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E480152 [] (trimmed) TTTTCTTGCCAAAGTTTCAGGTTTGAAACCAAGGTGATTGGCGGGAGACCAATTATAAAAAAAAAATACATTCATAGTATATATGTATAATATTA
GTACCAAAAAATAGTCTTCTCTTTTATCCCAAATAACAGTTAAGTTTCTAATCTCTTCTTTAATTACTTTTAATTTTACTTATTTTAATTTTTTA
TATATATAGTTGTTTGTGATGTATTTATGTTTATATATGTTTAGGGTTGAAAAGAACAGGTAAGAGTTGTAGGTTACGTTGGGTTAATTATTTGA
ATCCTGATCTCAAACATGGAAAGATGACTCCTCAAGAAGAACGTCTTGTTCTTGAACTTCACTCCAAATGGGGAAATAGATGGTCAAGAATTGCC
CGAAAAATACCAGGGCGTACTGATAACGAAATTAAGAATTACTGGAGAACCCATATGAGGAAGAAAGCTCAAGACCAGAGGAAAAAGTCTTCTAT
TTCTCCATCTTCATCATCTTCTTCTTCTTCAATCACTCACGAAGAAAATGAAAGAAACTTCTATGATACGGGTGGAATCAAGCTCTTGCAAGTTG
AAGGAGAAAAGAAATCTAGTGATCAAGAACACATGGAAAAAGTATGAAAGTTTACTCTATGGATGAAATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E480152] SGN-U270956 Solanum tuberosum Build 4 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T225373 [Download] [View] Facility Assigned ID: PTDBV71TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0129 Quality Trim Threshold: 14.5