Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E480521

Search information 
Request: 480521Match: SGN-E480521
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C228548Clone name: cSTD-14-O9
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E480521Length: 351 bp (1033 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E480521 [] (trimmed) GATATTTCAGATTCCTCTGATGTAAAACAGTCGCTAAAGCTTGGCATTCTTCCTCTAGTTCGTTAAACCTCTGAAAAACCCTACTCCATTTTTTT
GGCATTCTGAAAGTAATTAACACCCTCCATGGCTTCCCCTACCGAGACTTCAGAATCTTTCAAACCCTACGAGCTTAAATTCACTCTCTCCGGCC
ACAAACGCGCTATCTCCAGCGTCAAATTCTCCGACGATGGCAAAATCCTAGCCACCTCCTCCGCCGATAAAACTGCCCGAACATGGGATGTCTCC
GACGGATCCCTTCTTCACGAATTCCTAGGTCACGAACAGGGTATCTCCGATGTTGCCTTCTCCTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E480521] SGN-U275933 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T225742 [Download] [View] Facility Assigned ID: PTDCA89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0030 Quality Trim Threshold: 14.5