EST details — SGN-E480890

Search information 
Request: 480890Match: SGN-E480890
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C228812Clone name: cSTD-15-P9
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E480890Length: 647 bp (937 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E480890 [] (trimmed) CGAGGGTACTTTTTCTTCCACATGAGAAGTTCTTTCAAGCTTCCACATCTACGGTGTTGGTTTTGGTATTCCATCCATTTTCTACTCGCCCTTAA
TTCTTCTTATTCAGCGCCATGCCACTATAGCCACAGGGGAAGCGTTGGCCAAATCAGCTCCAATAGGAAGGAAGTTCTCGGAGCAGCATTCATTG
AAGAAGGGAGATATGGAGAAAGAAGGAAATTCAGTTGTTCTCGAGAAAAAAGATTTTGCAGTTCCAAGGAGAAAGGCTATGGCCCTGATACTCTC
CAGTTTTGTGCTCTCAAATTATGAATTGCCCAAAGTTGCATATGCTCAATCTGTTGAGTTCAGGGAATATATTGATACCTTTGATGGCTATTCGT
TTATGTATCCTCGAAACTGGATTCAAGTGCGTGGTGCTGGTGCTGACATATTTTTCAGGGATCCTCTTATTTTAGATGAAAATCTCTCAGTGGAG
ATATCATCTCCTTCATCCTCTAAGTACAAAAGTGTAAAAGATTTGGGTCCACCAGAAGAAGCTGGAAAGGGAGTCCTTAAACAATATTTGACTGA
ATTTATGTCCACTAGACTTGGTGTCAGACGCGAATCAAGTGTTCTTTCTACTTCATCAAAGGTAGCTGATGATGGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E480890] SGN-U271077 Solanum tuberosum Build 4 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T226111 [Download] [View] Facility Assigned ID: PTDCG89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0121 Quality Trim Threshold: 14.5