EST details — SGN-E481008

Search information 
Request: 481008Match: SGN-E481008
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C228924Clone name: cSTD-16-I21
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E481008Length: 686 bp (900 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E481008 [] (trimmed) TGAAAATGTATTTTGATTTCTTACATTCAGAGTCCATTGAAGACATGGGGTATTCTCTAAGTAGGTTAGAAGTAGAGACCGGACACTTTGATGGT
TCAAGTTCCAATCACGGGGTTGCTAGCAGTGTTCATCACGACAGACCAGCAAATTATTTGGACCATGAAATTTCTCAACTTACTAAGCTTAGATC
AGGGCCCCATGAAAATCTCAGTAGAATCCTACCCGGGAAAAAGGAAGTTCCTGTGTCCACATTCAAGATGTTAGCTGCTCGAGAAGCCAATATTT
CCGGTAGAGGAAGGTTTTCGAAGGCAGATTGTTGTCATGTTCTAAGTAAATATTTGCCGGTTAGTGGTCCTTGGATTGTGGACCAGATGGAAACC
AGGGCTTATGTATCACACTTTTCAGCAGATGGTTCCCTTTTTGTTGCTGCCTTTCAGGGAAGCCATATTAGAATATACAATGTGGAAAGAGGGTG
GAAAGTTCACAAGAATATTCATGCAGAAAGTTTGAGATGGACAGTTACTGATACATCTCTTTCTCCGGATCAACGTCATTTGGTGTATGCTACCA
TGTCACATATCGTACATATTGTAGACGTAGGATCTGCTGCCACTGAATCTGTAGCCAACATCACAGAAATTCATGATGGTTTGCTTTTGTCTGCT
GCCATGATGATTTTGGAATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E481008] SGN-U274636 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T226229 [Download] [View] Facility Assigned ID: PTDCI59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5