EST details — SGN-E481554
| Search information |
| Request: 481554 | Match: SGN-E481554 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C229399 | Clone name: cSTD-18-J5 |
| ||
| Library Name: cSTD | Organism: Solanum tuberosum |
Tissue: dormant tuber
Development Stage: one month post harvest
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E481554 | Length: 203 bp (1048 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E481554 [] (trimmed)
CGCGTTCTTAACCACGATCCTCGAAGAACACAAGGGAAAGCGAGTTGGAGAATCGAAGGAGCAGGGGGATTTGTTGAATACGTTGATCTCTCTGA
AAAATGAAGAAGACGATAATGGAGGAAAGCTTACTGATACAAAAATTAAAGCTTTACTTTGGGTACGCCTCTTACAATTATCTCTTTATTTCAAA
TTGGACAAGGAAA
AAAATGAAGAAGACGATAATGGAGGAAAGCTTACTGATACAAAAATTAAAGCTTTACTTTGGGTACGCCTCTTACAATTATCTCTTTATTTCAAA
TTGGACAAGGAAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E481554] | SGN-U283496 | Solanum tuberosum | Build 4 | 2 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T226775 [Download] [View] | Facility Assigned ID: PTDCS51TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.933 | Expected Error Rate: 0.0168 | Quality Trim Threshold: 14.5 |
Working
