EST details — SGN-E481608

Search information 
Request: 481608Match: SGN-E481608
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C229325Clone name: cSTD-18-F6
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E481608Length: 485 bp (936 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E481608 [] (trimmed) GAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTGGTGCAATCAATTACATATCAATATTTGCTGGTAATGACCCAGAAAACTGTACATATGT
GAATGTTTGAAAAAAATCATATACAAACAGAATGCCTGGTATGTACTACCTACCTAACCTAAGTAATCTTTATCAATAATTAGGATGATAAGAGA
CAAGTGCTGGATCTGGATAGACGACAGGCAATTTATCGATGTACATGAGAAGCCTCTTCATATTTTCCCTCGTTATTGTCGACAAGTCTTTGATG
TCACATATGTTGGTGTATATCCAAAGCTCTCCGGAATCCACCCTTTTGAGACTATCTCGACAGAAAGGGCATGACTGAGATCGGGCACGCCAATT
TCTATAACACTTCATGCATAAAGAGTGATTGCAGGAGGGCAAGACAACCTTTGTATCCATCTCCATGCAGATACCACATTCCTCCTCCCTCTCTA
TTTCGATTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E481608] SGN-U272075 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T226829 [Download] [View] Facility Assigned ID: PTDCT27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5