Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E481707

Search information 
Request: 481707Match: SGN-E481707
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C229722Clone name: cSTD-19-O17
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E481707Length: 604 bp (941 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E481707 [] (trimmed) CCACCCCAAATAATGGCGCGAGGCTCTTCTTCCCAATCCACCTCCTCCTCCACCACTCGCCCAGGGACCGCCGCACCCCGTGGTTCTGCCGCCGC
TACAGCTGGTATGCGCCGACGCAGGCTCGGTGCTTCTTACTCTGCGGGCGGTGGTGGTGGTAACGCTGTAGTAGGCTCCGGCAACGCTAGCAACA
TGCTTCGTTTCTATACCGATGATTCTCCAGGTCTGAAGATCAGCCCGACTGTCGTCCTTGTGATGAGCCTATGCTTCATCGGATTCGTTACTACT
CTCCATGTCCTCGGCAAATTCTACCGCTACCGATCTGGCTCTGGCTCCGGAGCCTGATTATTCGGGTTCGGATCTTTGATTTCGGATCATGGTGA
TTNTGAAACCCACGTCATACAGGAAAAAATTAGTTTGTTTGTTGTTTTTAATTTCAGTTTTCGTTTCACGATCGTTTGCTGGTTCTGTTTCCGTT
TTAGTTTTAGATGGCTGAATTTGACTCAGTATATTAGGAAGATGATAAAAGAAGCTTCCAATTAAGGGAATTTTGAACGTTTACATGTGCTTTGT
GTTTGGTTTAATCAGTAATGCATAGTTTTTGTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E481707] SGN-U274698 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T226928 [Download] [View] Facility Assigned ID: PTDCU93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.991 Expected Error Rate: 0.0143 Quality Trim Threshold: 12.5