EST details — SGN-E482016

Search information 
Request: 482016Match: SGN-E482016
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C230003Clone name: cSTD-20-D23
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E482016Length: 518 bp (1014 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E482016 [] (trimmed) GTTTGAGATCCTAATTTTTGGCGTTATGAAGAAGAAATGGTAAAGGCGGGTGAGACGGAAACGAAGAAGAAAGCAAAATGTTTCAAGGATAAGAG
GAAGAATATGCAAAGATTAGGAGGAGGAAGAGGAGGCTTATCATTGGAAGCATTTGCAAACGCCAAAACCAAGACCAACACTTACAACCCTGCCA
TCATAAGTATTCTTACGACACTGGGGAATTAAATTATTGCTTTTACCGAAAAAATAACTCTGCCGATTCTGAATCTATGGTCTGAAACAGTTGGT
TCTAATAGCATAGCATATATGTTGTATCTGTAATTGTGCTTTTCTTTTTGTGCAGAAAAGCAAAGGGAGTTCTATAAGAACGCCAAATATGTAAA
TAAATATAAGAGGATAGTTAAGCAGCAACAAGGAGAGCCTTCTGGTTCTGGTTCTGCAAGACAACTAGAGGATGAAGAAGGGAGAAGAAATAAGA
AGAATAGTGCTAGAAGCCTAAGACAAATATGTGAGAGAAAACG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E482016] SGN-U272888 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T227237 [Download] [View] Facility Assigned ID: PTDDA24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0124 Quality Trim Threshold: 14.5