EST details — SGN-E482309

Search information 
Request: 482309Match: SGN-E482309
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C230233Clone name: cSTD-21-D20
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E482309Length: 372 bp (691 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E482309 [] (trimmed) GAAGAGATAAGAGTAAACAAGAAGTGAAAAATTGGTAATTTTAAACAACTCCAAGATTTAGCAATCAGGTTTGGCATGGTAGGAACTTGATTATG
GATGATATGGTACTTCAAAGCGTCTCTCAGACAATCACCCCGTACTGTCTTACATGTGAAAATGAATTTTGATTTCTTACATTCAGAGTCCATTG
AAGACATGGGGTATTCTCTAAGTAGGTTAGGAGTAGAGACCGGACACTTTGATGGTTCAAGTTCCAATCACGGGGTTGCTAGCAGTGTTCATCAC
GACAGACCAGCAAATTATTTGGACCATGAAATTTCTCAACTTACTAAGCTTAGATCAGGGCCCCATGAAAATCTCAGTAGAATCCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E482309] SGN-U274636 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T227530 [Download] [View] Facility Assigned ID: PTDDF22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0085 Quality Trim Threshold: 14.5