Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E483526

Search information 
Request: 483526Match: SGN-E483526
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C237277Clone name: cSTE-9-D18
nocartOrdering Not Available
Library Name: cSTEOrganism: Solanum tuberosum

Tissue: periderm and subperiderm
Development Stage: 24 and 48 hour, and 5 and 7 day

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E483526Length: 302 bp (1049 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E483526 [] (trimmed) TTCAAGTATTGCCCTGGGTGCCTTGACAAACTTAAGGCTGAACCGTGAGCCGTGGTATCACCATTGATATTGCTTTGTGGAAGTTTGAGACCACT
AAGTACTACTGCACTGTGATTGATGCCCCCGGACACAGAGACTTTATCAAGAACATGATCACTGGTACTTCCCAGGCTGACTGTGCTGTCCTCAT
TATTGACTCCACCACTGGTGGTTTTGAAGCTGGTATCTCTAAAGATGGTCAGACCCGTGAACATGCATTGCTTGCTTTCACCCTTGGTGTCAAGC
AAATGATCTGCTGCTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E483526] SGN-U277726 Solanum tuberosum Build 4 467 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T228747 [Download] [View] Facility Assigned ID: PTEBJ21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0093 Quality Trim Threshold: 20.5