EST details — SGN-E484027

Search information 
Request: 484027Match: SGN-E484027
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C232477Clone name: cSTE-11-H8
nocartOrdering Not Available
Library Name: cSTEOrganism: Solanum tuberosum

Tissue: periderm and subperiderm
Development Stage: 24 and 48 hour, and 5 and 7 day

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E484027Length: 420 bp (932 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E484027 [] (trimmed) CCCAAGCCCTCGAACGAATTAAAAGCCGCAATCTCCATGGGAACTCTCTTCTTACTCTTGAATCCGTCGCTTGATGAACACCAGCCACCGTAGAA
CCACTTCAATTGATTTCAAAATATCAAAAGCCTCGTCAACAACTCTTTGCTCCTATAGCTAAACCAATCGAGGAAGATTCCGATTCCGACGAATT
CAGAACCTCACCGCCAGGAAGAATACAGACCCGATGATGAAGGATGGTGACAATGATGTAGATACGCATGTTGCTGAAAAGAAGCCATTTTTTGC
ATCATCAGAAGGAGTTACATTTCATGCAAATTCGTTTATTGAGCTCCATATCTCAAGGCCGTTGCTTCGGGCTTGTGAACATTTGGTTACAGTAA
GCCTACCCCAATTCANGCGGCCTGCATTCCATTGGCTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E484027] SGN-U274676 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T229248 [Download] [View] Facility Assigned ID: PTEBR40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0318 Quality Trim Threshold: 14.5