| SGN ID: SGN-C233047 | Clone name: cSTE-13-K14 |  | Ordering Not Available |
|
| Library Name: cSTE | Organism: Solanum tuberosum |
Tissue: periderm and subperiderm
Development Stage: 24 and 48 hour, and 5 and 7 day
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E484444 | Length: 219 bp (916 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E484444 [] (trimmed)
CTTTCTTTGATATCTCAAACATTTGAGACTTTTGGTGGTGTTACTTCCTATTGTTTACCTTCAGCTGAAGCCAAGTCCTCTGGCTCATTAGTACT
AGGAGGTGACAGTAACACTTCACTTTTCAACAGCTCTACACCTATTTCTTACACTAGATTGTTAACAAATCCACAGCTTGTTACCTTCTATCTAC
TCAGTCTAACCGGGGTTACTATCGGGGGG
[BLAST] [AA Translate]
| SGN-ID: SGN-T229665 [Download] [View] |
Facility Assigned ID: PTEBX67TH
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.954 |
Expected Error Rate: 0.0244 |
Quality Trim Threshold: 14.5 |
