Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E484501

Search information 
Request: 484501Match: SGN-E484501
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C233045Clone name: cSTE-13-J7
nocartOrdering Not Available
Library Name: cSTEOrganism: Solanum tuberosum

Tissue: periderm and subperiderm
Development Stage: 24 and 48 hour, and 5 and 7 day

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E484501Length: 380 bp (948 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E484501 [] (trimmed) CGTGAACCTGACAAGTGTAAGCGTGGGGCGAGTTCCGGTCCCGATTGCACCCGAACCCCTTGCGTTTGACCCCGAACCACCGGTGCGGGCCACCG
GTAATTGACTCAGGTACCGGTCATTACCCGATTCGTCCAACCGGCTTACGAAGCGATTAGGGATGAATTTAGGAAACAAGTGAATGGGAACATTT
AGCTCATTAGGTGCATTTGATACATGTTTTGTATCACAAAATGAGGCAGTGATACCAACTATAACATTGCACTTTGAGGGAATGGACTTGAAATT
GCCAATGGAGAACACATTGATACATAGTAGTGCCACTCCCTTGGCATGTTTGGCTATTGCATCAGCACCAAATAATGTAAATTCAGTGTTGAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E484501] SGN-U270605 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T229722 [Download] [View] Facility Assigned ID: PTEBY52TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0257 Quality Trim Threshold: 14.5