SGN ID: SGN-C234027 | Clone name: cSTE-18-C6 |  | Ordering Not Available |
|
Library Name: cSTE | Organism: Solanum tuberosum |
Tissue: periderm and subperiderm
Development Stage: 24 and 48 hour, and 5 and 7 day
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E485507 | Length: 254 bp (990 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E485507 [] (trimmed)
GTTATTCTTCATACGCGGCCAGGGTTTTAGCGAAGCTCTTTCTCTCATTTTTTCGTTTGTGAAAGTTTTTTAGACATCATGGGTAAAGAGAAGAT
TCATATCAGCATTGTTGTCATTGGACATGTCGACTCTGGAAAGTCGACCACTACTGGTCACTTGATCTACAAACTTGGTGGTATTGACAAGCGTG
TCATCGAGAGGTTTGAGAAAGAAGCAGCTGAGATGAACAAGAGGTCCTTCCAGGATGCGTGGGT
[BLAST] [AA Translate]
SGN-ID: SGN-T230728 [Download] [View] |
Facility Assigned ID: PTECR15TH
|
Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 |
Expected Error Rate: 0.0115 |
Quality Trim Threshold: 14.5 |