Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E485675

Search information 
Request: 485675Match: SGN-E485675
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C234267Clone name: cSTE-19-E13
nocartOrdering Not Available
Library Name: cSTEOrganism: Solanum tuberosum

Tissue: periderm and subperiderm
Development Stage: 24 and 48 hour, and 5 and 7 day

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E485675Length: 635 bp (907 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E485675 [] (trimmed) ATAGATCCCTCCTTCAAAAAGCTCTTTTCAGGGATCATCATCAAGGAAGCGTAATGGGGCTCACATTCACCAAGCTCTTCAGTCGGCTTTTCGCC
AAGAAGGAAATGCGCATTCTAATGGTTGGTCTTGATGCAGCTGGTAAGACCACCATATTGTACAAGTTGAAGCTGGGAGAGATCGTGACTACTAT
TCCTACCATTGGTTTCAATGTGGAGACTGTTGAGTACAAGAACATCAGCTTCACTGTTTGGGATGTCGGGGGTCAGGACAAGATCCGTCCATTGT
GGAGGCACTACTTTCAGAACACTCAGGGTCTCATTTTTGTGGTTGATAGCAATGATAGAGACCGTGTTGTAGAAGCAAGAGATGAATTGCATAGG
ATGTTGAACGAGGATGAACTTCGGGATGCTGTGCTTCTAGTTTTTGCTAACAAGCAAGATCTTCCTAATGCAATGAATGCTGCCGAAATAACTGA
TAAGCTTGGACTGCACTCCCTCAGGCAGCGTCACTGGTACATCCAGAGCACTTGTGCAACTTCTGGAGAGGGGCTTTACGAGGGACTTGATTGGC
TTTCTAACAACATTGCTAACAAGGCTTAAAGTGATGCAGATTTGTTATTGTGGGTTGATCTGGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E485675] SGN-U268253 Solanum tuberosum Build 4 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T230896 [Download] [View] Facility Assigned ID: PTECU31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5