EST details — SGN-E486007

Search information 
Request: 486007Match: SGN-E486007
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C234518Clone name: cSTE-20-F17
nocartOrdering Not Available
Library Name: cSTEOrganism: Solanum tuberosum

Tissue: periderm and subperiderm
Development Stage: 24 and 48 hour, and 5 and 7 day

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E486007Length: 589 bp (902 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E486007 [] (trimmed) CTTCCCTGTTCGTTCTCCCTTCCAGAATAATTGTAATGACTTCTGCAAGTGCAAACGAGAATTGCCTTGGTTGGGCAGCAAGAGATCCGTCTGGA
GTTCTTTCACCTTATGAATTCAACCGGAGGGCAGTCAGCAGTGATGATGTTCTGCTAGACATTGCATTTTGTGGGATGTGTTTCGCTGATGTTAT
CTGGACCAGGAATATAATTGGAACTTCAAAATATCCTCTTGTGCCAGGACATGAAATTACGGGAATTGTGAGAGAGGTTGGTACGGATGTTAAGC
ACTTCAAAGTTGGCGACCATGTTGGAGTTGGAACATATGTTAATTCATGCAGGGAATGTGAATATTGTTGTGATGCATTAGAGGTTCATTGCTCA
GAAGGAGCAATAAACACTTTTGATGGTATAGACGTCGATGGTACAGTTACTAAAGGGGGATACTCCAGTTACATTGTAGTCAATGAAAGGTACTG
CTTTAGAATACCTGAAAATTACCCGCTTGCATCTGCAGCACCTTTACTATGTGCTGGAATTACTGNTTATACTCCGATGATAAGACATAACATGA
ACCAACCGGGGAAATCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E486007] SGN-U271724 Solanum tuberosum Build 4 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T231228 [Download] [View] Facility Assigned ID: PTEDA33TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0112 Quality Trim Threshold: 14.5