Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E486511

Search information 
Request: 486511Match: SGN-E486511
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C235147Clone name: cSTE-22-K4
nocartOrdering Not Available
Library Name: cSTEOrganism: Solanum tuberosum

Tissue: periderm and subperiderm
Development Stage: 24 and 48 hour, and 5 and 7 day

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E486511Length: 496 bp (879 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E486511 [] (trimmed) ATTCTTCATACGCGGCCAGGGTTTTAGCGAAGCTCTTTCTCTCATTTTTCCGTTTGTGAAAGTTTTTTAGACATCATGGGTAAAGAGAAGATTCA
TATCAGCATTGTTGTCATTGGACATGTCGACTCTGGAAAGTCGACCACTACTGGTCACTTGATCTACAAACTTGGTGGTATTGACAAGCGTGTCA
TCGAGAGGTTTGAGAAAGAAGCAGCTGAGATGAACAAGAGGTCCTTCTAGTATGCGTGGGTGCTTGACAAGCTTAAAGCTGAGCGTGAACGTGGT
ATTACTATTGATATTGCCTTGTGGAAGTTTGAGACCACAAAGTACTACTGCGCTGTGATTGATGCCCCTGGTCACAGGGATTTCATCAAGAACAT
GATTACTGGTACCTCTCAAGCTGACTGTGCTGTCCTCATCATTGACTCCACAACTGGTGGTTTTGAAGCTGGTATTTCCTAGGATGGGAAGATCC
GTGAGCATGCATTGCTTGCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E486511] SGN-U277731 Solanum tuberosum Build 4 274 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T231732 [Download] [View] Facility Assigned ID: PTEDH62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0179 Quality Trim Threshold: 14.5