EST details — SGN-E487062

Search information 
Request: 487062Match: SGN-E487062
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C235702Clone name: cSTE-24-I19
nocartOrdering Not Available
Library Name: cSTEOrganism: Solanum tuberosum

Tissue: periderm and subperiderm
Development Stage: 24 and 48 hour, and 5 and 7 day

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E487062Length: 360 bp (1065 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E487062 [] (trimmed) GCAGAAGTCAGCTGGATCTTATTATTACTTGGATGATTAACCAGAACAGGTGCTAATCGATGATCACGAGCAGCCTCTGGGCATTTTTATACCAT
AGACCTCTGACGTGATTATTAAGAGGTTAACGTCTGAGCAAACAGATGATTGGATATCAGCAGAATGCCTTTTGTTTCGTCGTTGATTTAGTAAT
TATTACTGGTATTATGTACTCATAAATGTAGTTTTGTTCACCAATTTTGACAGCAGATGGAGTAGTTGATTTCTCATTTTGTATGTTTTATCTTT
GGCACATGAATGAGTCATTTGATTGGGTTGATGAAAACTGGAGTGACATTTATGCAGTAAGCCACAGTTTATTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E487062] SGN-U273480 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T232283 [Download] [View] Facility Assigned ID: PTEDO58TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0014 Quality Trim Threshold: 12.5