EST details — SGN-E487407

Search information 
Request: 487407Match: SGN-E487407
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C236055Clone name: cSTE-25-M18
nocartOrdering Not Available
Library Name: cSTEOrganism: Solanum tuberosum

Tissue: periderm and subperiderm
Development Stage: 24 and 48 hour, and 5 and 7 day

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E487407Length: 772 bp (902 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E487407 [] (trimmed) CCGAAGCACTCGGCGATTTTGTACTCTTTTTTTTCCTTCTCTCTCAGTTGGGGTGGATCCTGATCGGGATTTGAATCAAGCTGCTTCAAGATGTC
AACATACACCCCTAAGAATATACTCATTACTGGAGCTGCCGGATTTATTGCATGTCATGTAGCCAACAGGCTTGTTCGGAGCTACCCTGATTACA
AGATTGTTGTCCTTGACAAACTTGACTATTGTTCAAATTTGAAGAACCTTATTCCTTCCCGATCTTCCCCTAATTTCAAGTTTGTTAAGGGAGAC
ATTGCTAGTGCAGATCTCGTTAACTACCTTCTCATAACTGAGTCCATTGACACTATAATGCACTTTGCTGCTCAGACCCATGTTGATAACTCCTT
TGGTAATAGCTTTGAGTTCACTAAGAATAACATCTATGGTACCCATGTACTATTAGAGGCCTGCAAAGTTACTGGTCAGATCAAAAGGTTTATCC
ATGTGAGTACAGATGAGGTCTATGGGGAGACTGATGAGGATGCTGTTGTAGGAAACCACGAAGCCTCACAACTCCTTCCCACTAACCCATATTCA
GCCACAAAAGCTGGGGCTGAAATGCTTGTTATGGCTTATGGTAGATCATATGGGTTACCTGTTATAACCACTAGAGGGAACAATGTCTATGGTCC
TAACCAATTTCCTGAGAAACTAATCCCTAAAGTTATACTTTTAGCCATGAGGGGAAAGCCTCTTCCTATTCATGGTGATGGTTGTAATGTTCGTA
GTTATCTCTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E487407] SGN-U269958 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T232628 [Download] [View] Facility Assigned ID: PTEDT81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0053 Quality Trim Threshold: 14.5