Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E489027

Search information 
Request: 489027Match: SGN-E489027
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C283000Clone name: KS01011E11
nocartOrdering Not Available
Library Name: KS01Organism: Capsicum annuum

Tissue: leave
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E489027Length: 399 bp (758 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E489027 [] (trimmed) CAGAGGTATTGACAAATGCTGAAATTAATTATCGAACTTTATGAATCAGAAGCAAGTACTTTTCTATGTTAAATTTGGTTAAGTTGAGAAAAAAA
TTACTTTTCTATGGAGTGACACATCTCTTCATCCGTCTCACTGCAAAATGAAGGATTTTCTAGTCTTCAGAGAGCACTGATAAATGCTTAAATTG
ATTATCAAATTTTACGAGTCTGAAACAATTACTTTACTACTTACTTTCTGTGGATTGATGTGCTTCTTTAATTCTTGTCTTTGCAAAATGAAGGC
ACTTCCCTAGGGGTATTGATATTTACTTTGACAACGTTGGAGGAAATATGCTGGATGAGGTTCTTTCGCACATGAATCTCTATGGTAGGATTGCA
GTTTCTGGGATGATCTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E489027] SGN-U196622 Capsicum annuum Build 1 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T289704 [Download] [View] Facility Assigned ID: KS01011E11
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5