EST details — SGN-E489719

Search information 
Request: 489719Match: SGN-E489719
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C283692Clone name: KS01018H02
nocartOrdering Not Available
Library Name: KS01Organism: Capsicum annuum

Tissue: leave
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E489719Length: 286 bp (740 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E489719 [] (trimmed) TCGACTGAGGCCTCAATTTCATCTTCTAGATCGGAAAATGACGTCATCATCTCCGATCACTATGATGATGATGAAGTTAAACCACTGCTCTCCGT
CGCCGCCGTATACCACCGTCGCAGCTCGTCGGCTCCTACCACCGCTTATTGGGCCCCACCAAATTCAGTTGCGTTCCTCTCTGGGTCCCACCCTT
CACAACTCCCCATCTTTTTCCGCTAGAGCCATCATGGCTCGTTCAGCGTCTTCCTCTTCCTCCTTCGTAATCACTGCTGCAATGGCTAGTGAAGC
A
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E489719] SGN-U204503 Capsicum annuum Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T290396 [Download] [View] Facility Assigned ID: KS01018H02
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0185 Quality Trim Threshold: 14.5