EST details — SGN-E491076
| Search information |
| Request: 491076 | Match: SGN-E491076 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C283712 | Clone name: KS01021A11 |
| ||
| Library Name: KS01 | Organism: Capsicum annuum |
Tissue: leave
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E491076 | Length: 179 bp (798 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E491076 [] (trimmed)
TCGAGTTTTTTTTTTTTTTTTTTTTATTTACAGATAACTAACCAACTAAGTATTATCATTGGCTCCGGATACAAATTCTGTAATCATACGACAGT
ACATAGAGAATATAACAAAGTCCAGATATACCTCCATCCAGGCAATGCAGTATCAGAATGAGAAATCATTCTTAGCAATGGAGA
ACATAGAGAATATAACAAAGTCCAGATATACCTCCATCCAGGCAATGCAGTATCAGAATGAGAAATCATTCTTAGCAATGGAGA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E491076] | SGN-U198904 | Capsicum annuum | Build 1 | 2 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T290416 [Download] [View] | Facility Assigned ID: KS01021A11 |
| Submitter: Kribb | Sequencing Facility: KRIBB |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.917 | Expected Error Rate: 0.0217 | Quality Trim Threshold: 14.5 |
Working
