EST details — SGN-E491136

Search information 
Request: 491136Match: SGN-E491136
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C283772Clone name: KS01021G03
nocartOrdering Not Available
Library Name: KS01Organism: Capsicum annuum

Tissue: leave
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E491136Length: 416 bp (756 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E491136 [] (trimmed) GAATATCTTAGTGATAGGATAGGTATCTTCGAGGACGGGAACTTCCAGTGCTTGGGAACCGCAGATGAGTTAAAAGCTAGGTATGGGGGATCCTA
CATGTTCACTATGACTACATCACCATAGAATGGGAGTGAAGTGGAAAACTTAATGAAACGTGTATCTGCAAACGCACAGAATACCTATCATTTGT
ATGGAACTCAGAAATTTGAGCTTTCAAAAGGTGAAATGAAACTTTCATATGTGGTCCTAACGGTTAGACAATCGAATGCGAGATTTTCAGTTCAA
TCTTGGGGCTTGGCTGACACATCGCTGGACGACGTCTTTATCTAGGTGGCTACTGAGGCAAACTGATCACTTTTTTACTGCTAATCTTATAGTCA
TGTCGAATTCCTTATTCTCTTGCTTGTAAGATATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E491136] SGN-U196268 Capsicum annuum Build 1 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T290476 [Download] [View] Facility Assigned ID: KS01021G03
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0332 Quality Trim Threshold: 12.5