EST details — SGN-E491348

Search information 
Request: 491348Match: SGN-E491348
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C283984Clone name: KS01026A03
nocartOrdering Not Available
Library Name: KS01Organism: Capsicum annuum

Tissue: leave
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E491348Length: 578 bp (701 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E491348 [] (trimmed) GAGGAACACTGTCGATACTGGAAGAACCGTTGTTTGTACCATTCATCAACCTAGCATTGACATTTTCGAAGCTTTTGATGAGTTATTTCTTATGA
AACGAGGAGGACAAGAGATATACGTTGGTCCATTAGGTCGCGAATCATGCCATTTGATAAAATATTTCGAGGCGATACCCGGTGTAAGCAAAATA
CACGAAGGTTACAATCCAGCAACTTGGATGTTAGAAGTCACATCCTCATCTCAAGAAATGGCATTAGGGGTCGATTTTACAGAATTGTACAAGAA
CTCAGACCTCTGCAGGAGGAACAAAGCTTTGATCGAGGAACTAAGCGTGCCACAACCTGGGACAAGTGACCTGCATTTTGAAACTCAATTCTCAC
AGCCATTTTGGGTCCAATGTATGGCTTGCTTGTGGAAGCAACACTGGTCATATTGGCGTAATCCGGCATACACAGCAGTCAGATTTCTCTTCACA
ACATTCATAGCACTCATATTTGGGTCAATGTTCTGGGATAATTGGTACCAAAACGACTAGGCCCCAAGATCTAACTAATGCTATGGGGTCTATGT
ATGCCTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E491348] SGN-U196479 Capsicum annuum Build 1 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T290688 [Download] [View] Facility Assigned ID: KS01026A03
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.987 Expected Error Rate: 0.0060 Quality Trim Threshold: 14.5