EST details — SGN-E491408

Search information 
Request: 491408Match: SGN-E491408
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C284044Clone name: KS01026F03
nocartOrdering Not Available
Library Name: KS01Organism: Capsicum annuum

Tissue: leave
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E491408Length: 486 bp (690 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E491408 [] (trimmed) GATCCAAGAAAGACACTATGGAGAAGTTAGCTCATTTTGTTGCTTTCTTGCTTCTTGCATCACTCTTCCAACCTCTCACTGCTCGAGAATTGGAA
ATTGATGTCCTCCAACTTGACGTTTCTCAGTCTAGTTGTCCAGGAGTGAAAAAGGACACATGGCCAGAACTTCTTGGGGTACCATCTGCGTTTGC
AAGACGAACAATTAAGCAGGAAAATCCAAAGCTAACAAATGTTCCAAGTGTACTGAATGGTTCTCCAGTTACAGCAGATTTTAGATGTGATCGAG
TTCGTCTTTTTGTTAATGTCTTAGGTTTTATTGTACAAACTCCCCGGGTTGGTTGAGGAAGTTAGAAAATTTATTCGCATCGAGTGTTGTAAGTA
TATCTACTAGGTAGCCCCAAGAAAAATAATTGGAGCAGTATGGACATTGCATCCATGTATTCCAATGCTATTTGGAGTGATAAATAAGTGTGGAT
TTTAATGTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E491408] SGN-U196517 Capsicum annuum Build 1 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T290748 [Download] [View] Facility Assigned ID: KS01026F03
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0059 Quality Trim Threshold: 12.5