Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E493368

Search information 
Request: 493368Match: SGN-E493368
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C287922Clone name: KS01067A07
nocartOrdering Not Available
Library Name: KS01Organism: Capsicum annuum

Tissue: leave
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E493368Length: 673 bp (742 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E493368 [] (trimmed) AAAACTCCCATTGCCATTTCCAAAGCTTCTCCATTTTCTTCTTCAATTCAATGGCGTCGGTAGCATTCAGAAATCCAAATTCGAAGCGCGTGTTT
TCACTCTCTCCACAAATCTATTCCTCCTGTAGAGGAGGAGCAGTTTCCTCTCACTTTTCACTTTCGGAGTCGCTGCTAAATGCAAATGAAAATCC
CAATTTGTCTAATCCTTGGTGGAGATCCATGGCCACTTTCACTCGAACGAAACCTCATGTAAATGTGGGAACTATTGGCCACGTTGATCACGGGA
AGACTACTCTTACTGCTGCAATTACAAAGGTTCTAGCAGAAGAAGGAAAGGCCAAGGCGATTGCATTTGATGAAATTGACAAAGCCCCTGAAGAA
AAAAAGAGAGGAATTACTATTGCCACAGCCCATGTGGAGTATGAGACGGCTAAAAGACATTACGCTCATGTTGACTGCCCAGGACATGCAGATTA
CGTTAAAAATATGATTACTGGAGCTGCTCAAATGGATGGTGGTATTCTAGTTGTATCTGCTCCAGATGGACCTATGCCACAAACAAAGGAGCACA
TTCTTCTTGCCCGCCAGGTCGGCGTACCCTCTCTTGTCTGCTTTTTAAATAAAGTTGATGCTGTTGATGATCCTGAGCTGCTGGAACTTGTCGAA
ATGGAGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E493368] SGN-U197019 Capsicum annuum Build 1 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T294626 [Download] [View] Facility Assigned ID: KS01067A07
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0005 Quality Trim Threshold: 14.5