Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

EST details — SGN-E495227

Search information 
Request: 495227Match: SGN-E495227
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C288916Clone name: KS07002D05
nocartOrdering Not Available
Library Name: KS07Organism: Capsicum annuum

Tissue: Flower bud
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E495227Length: 544 bp (991 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E495227 [] (trimmed) TCAACCAAGATGCACGTATCGTTGCTCAAAGACATCATATAAGAAGCCGTGCATGTTTTTCTGCCAGAAATGTTGTGCAAAGTGTTTGTGTGTTC
CTGCTGGTACCTATGGGAATAAGCAAACTTGCCCTTGCTACAACAACTGGAAGACCAAGAGAGGTGGCCCAAAGTGCCCATGATCTACATATATA
TATATCCCATCTATTACTCAACTTCTGTCAAATTGGTCTATTAATTAGATCAACATCTGGTTCAAGTGGCGTGTATTAGCTTAGTACTAGAATGG
TCAAATTATTAGGGCCCAATTAATTATATATATAGAAGAAGATTAATGTGCTAGCTACAAGTACTATATATAGCATGGTTATAATTCTGTAATGG
CCAGTAGTGTTTTATGTTACTTATTTTATTATGATTATTATTATTATTATCTTTAGTAATATTTATTGGCGTACCCCTTCTTCTGTGTAAGAATT
AACATGTATTTTAAGTCATTTAATCCAAGGACGATTTAATGGTGTTTTAAAAAAAAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E495227] SGN-U196364 Capsicum annuum Build 1 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T295620 [Download] [View] Facility Assigned ID: KS07002D05
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0022 Quality Trim Threshold: 12.5