EST details — SGN-E495897

Search information 
Request: 495897Match: SGN-E495897
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C289586Clone name: KS07009D03
nocartOrdering Not Available
Library Name: KS07Organism: Capsicum annuum

Tissue: Flower bud
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E495897Length: 682 bp (896 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E495897 [] (trimmed) CGGGTCGAACTACGGCGGCGAACGACCACCGACGGAGATGGCTCCACTATTCCCAGGATGTGATTATGAACATTGGCTTATTGTTATGGATAAGC
CTGGTGGTGAAGGTGCTACTAAACAACAGATGATTGATTGTTACATACAAACATTGGCTAAAGTTGTTGGAAGTGAAGAAGAGGCCAAGAAGAAG
ATATACAACGTTTCCTGCGAAAGATACTTCGGTTTTGGATGTGAGATTGATGAGGAGACATCAAATAAGCTTGAAGGTTTGCCTGGTGTTCTCTT
TGTCCTACCAGATTCATATGTTGATCCTGAGAACAAGGATTATGGAGCTGAGCTATTTGTGAATGGGGAGATCGTTCAAAGGTCACCTGAAAGAC
AAAGGAGAGTGGAGCCAGTACCCCAAAGAGCTCAAGACAGACCCAGATATAATGACCGAACACGTTACACAAGGCGCCGTGAGAACACGCGGTGA
AGACCGACTTCCAGTGTGATTTTGTACTACTACACCAACTACGCCTCAATCCCAAACAAGTCGGGGCTCTACGTGATAGTAGTCCCAACTTATTT
ATCTATCCTAGTTGAGGAAAAAAGAATGTATTAGTTGGAACAAGTTTGTGTCTCATGCAAGGTCATTCATGTGTAAAGATTAGTCTTGTTTGATT
GTATTCTGATATAGCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E495897] SGN-U197459 Capsicum annuum Build 1 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T296290 [Download] [View] Facility Assigned ID: KS07009D03
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0046 Quality Trim Threshold: 12.5