Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E496712

Search information 
Request: 496712Match: SGN-E496712
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C289861Clone name: KS07012C02
nocartOrdering Not Available
Library Name: KS07Organism: Capsicum annuum

Tissue: Flower bud
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E496712Length: 640 bp (827 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E496712 [] (trimmed) GTTGAAGGAGTTGAGAGACCACACTGACCCTAACATTGTGGTCATGCTCCTTGGCAACAAATCAGATCTCCGACATCTCGTGGCTGTTTCAACTG
ACGAGGCTAAATCTTTGGCAGAGAGGGAGGCATTATACTTCATGGAGACTTCCGCTTTAGAAGCAACCAACGTTGAAAATGCATTTACTGAAGTT
TTCACGCAGATATACCGGATTGTGAGTAAGAAGGCAGTTGAGGCAGGCGATGAAGGTGCTACTTCATCTGCTCCACCTAAAGGACAGACAATTAA
GTCTGCTTGGAAAAAGTTCGGGTGCTGCTCAAGCTAGGGTTCGAGGAAACTATGTAAGATGATAGCTCAAGCTTTATCTGTTGTAAATTGTCATT
AAATCAACGATTTCCTCCCCCCGGCTTCTTTTCTTTGGTTATCGCGCTTGTGGGATTACGCGAAGCAGCGTTCTCATGAAAACGCCGAAGCAGCA
GGTATTGTTAGGTTCTAATTACAGAATGTCTGTCTGAAACAAGGTCTAGTTTTATTATGTGCTCTGGATGATGGCTTGAGAAATGGCGGAAATGT
CGAAATCTTTCAAATAACATGTTACTGATATCTTCTTGTGTCAGATGAAATCTCAGTTTTTTTTTTACCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E496712] SGN-U196724 Capsicum annuum Build 1 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T296565 [Download] [View] Facility Assigned ID: KS07012C02
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0022 Quality Trim Threshold: 14.5