EST details — SGN-E497624

Search information 
Request: 497624Match: SGN-E497624
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C290773Clone name: KS07021G02
nocartOrdering Not Available
Library Name: KS07Organism: Capsicum annuum

Tissue: Flower bud
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E497624Length: 639 bp (863 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E497624 [] (trimmed) ACAGATGAAACAGATGAGGCAAATGAAGATGAATCTATTGTTCATCAGTGTGCTAGTGTTGGTGATGCAGAGGGCTTGAAGGCTGCACTAGCTGC
TGGTGCTGACAAAGATGAAGAAGATTCAGAAGGAAGGACAGCATTGCATTTTGCTTGTGGATATGGCGAGGTGAAGTGTGCTCAGATCCTTGTTG
AAGCTGGGGCAAAGGTTGATGCATTGGACAAGAACAAGAATACTGCTCTTCACTATGCTGCTGGATATGGTAGGAAGGAATGTGTAGCACTGCTG
CTAGAGAATGGAGCTGCCGTAACTCTTCAAAACTTGGACGGAAAGACGCCAATTGATGTTGCCAAACTCAACAACCAGCAGGACGTCCTTAAGCT
ACTTGAGAAGGATGCATTTCTGTAAACTGGCATGGATGTTGGGCCATGTACAATTGAAACTTTTGGATGTCACAGAGAGTGATTATCTTTGCCAG
TGTATAATTTTATTGTTTTCCCAAGATTGCCTGTTCAAAGAATTTGCTCTGGATGTTTTGTATTTGTAAACATCTTTGCTACCATGTTAAATTAA
TCTTCAACAAATTTTTTTCAAACTGATATAGTAGGCTTTGCCTCTACCTTGACAAGGTAGGCGGGGTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E497624] SGN-U197622 Capsicum annuum Build 1 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T297477 [Download] [View] Facility Assigned ID: KS07021G02
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0053 Quality Trim Threshold: 12.5