EST details — SGN-E501770

Search information 
Request: 501770Match: SGN-E501770
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C301453Clone name: KS09087B09
nocartOrdering Not Available
Library Name: KS09Organism: Capsicum annuum

Tissue: Young fruit (0.5-2 cm)
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E501770Length: 374 bp (650 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E501770 [] (trimmed) GTTGTTGAGGAGAGTAGTGAGCAATGGCTGCTTCCACACAATGCTTCTTGCACCAATACCATGCACTCTCTAGCCCTGCTAGAAGTAGAACATCC
TCCGTTTCAACCCTCAAGCCTAACCAATTGGTTTGCCGTGCCCAAAAGCAAGATGATGCCAACAACAATGGTTCCATCTCCCGCCGATTGGCTCT
CACTTTCCTCATTGGTGCTGCTGCCATTGGTTCGAAGGTTTCCCCTGCCGATGCTGCCCTATGGAGAAGCTGCGAATGTTTTTGGAAAACACCCA
AAGGAGAACACCTGATTTTTCATGCCATACAACGGAGATGGATTCAAGCTGCAAGTGCCATCCACATGGAACCCAAGCAAAGAAGTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E501770] SGN-U196275 Capsicum annuum Build 1 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T308157 [Download][View] Facility Assigned ID: KS09087B09
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0235 Quality Trim Threshold: 14.5