EST details — SGN-E502758

Search information 
Request: 502758Match: SGN-E502758
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C299661Clone name: KS09048G05
nocartOrdering Not Available
Library Name: KS09Organism: Capsicum annuum

Tissue: Young fruit (0.5-2 cm)
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E502758Length: 576 bp (1021 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E502758 [] (trimmed) CTCATAAAAACAAAGTAAGGGAAAAACATTAAACCATATGGCAAGTTGTAACATGGCTTCTGCTGCATCAAGTTTTTTGGTTGCAACTCCTAATG
TTGTCTCTAATAACACAACCAATTCTCGTACCAATATGTTGTATTTCTCCTGCAACAAGACCACCCCGAGACTTGTCGTAAGGGCGGCCGAGGAA
GAGGCTGCCCCAGCACCAGCAGCGGCCGCGGCTACTGCTGAACCAGCTGTTGAAACCAAAGCTGCTAAGCCACCTCCAATTGGTCCCAAGAGAGG
AGCCAAGGTGAAAATTCTTAGGAAGGAATCTTACTGGTACAAGGGCACTGGTTCAGTTGTAGCTGTTGATCAGGATCCAAAAACTCGTTACCCAG
TTGTTGTAAGATTTAACAAAGTGAATTATGCAAATGTTTCAACCAACAACTATGCATTGGATGAAATTGAAGAAGTGAAATGAAACTGTGTGCAC
TCAGTCAATTGGAATTAGTAGAATTGCAAGGCCCTTTGGTTTTCATGTTTATCCCTCTACTTATATATTATATACTGGGTTTGAATGTGAATGAA
TGTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E502758] SGN-U196507 Capsicum annuum Build 1 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T306365 [Download][View] Facility Assigned ID: KS09048G05
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0171 Quality Trim Threshold: 12.5