EST details — SGN-E503253

Search information 
Request: 503253Match: SGN-E503253
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C298305Clone name: KS09026B07
nocartOrdering Not Available
Library Name: KS09Organism: Capsicum annuum

Tissue: Young fruit (0.5-2 cm)
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E503253Length: 333 bp (1264 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E503253 [] (trimmed) GAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTTTTTTGTGAATCTCCAACAAGTTCAACAATTAAGAGTATATAATAAGTCTCATCACACTTT
CAATTCCCCTATCTACTACTTACCCCAAAGGGGCAAACTGACAAAGCCAAAGAATGTAAATCAGAAAACATATAAAGAGAAAAATGACTAAAAAG
ATTGTTCTAGCATACTCGACGAACGAACGAACAAACAAGCAAACAAAACTGCAGGATCTCCCTCCGCCCATCCTTCTTTCCAAGGCAAAATAACA
TGTACATTGTAGCCAGGTGCAAGGAACGAACGGACTACTGTTGCTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E503253] SGN-U196437 Capsicum annuum Build 1 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T305009 [Download][View] Facility Assigned ID: KS09026B07
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0229 Quality Trim Threshold: 14.5